rhino1.7.6.testsrc.benchmarks.sunspider-0.9.1.string-fasta.js Maven / Gradle / Ivy

Go to download

Show more of this group Show more artifacts with this name
Show all versions of rhino Show documentation

Rhino is an open-source implementation of JavaScript written entirely in Java. It is typically embedded into Java applications to provide scripting to end users.

There is a newer version: 1.7.15

Show newest version

// The Great Computer Language Shootout
//  http://shootout.alioth.debian.org
//
//  Contributed by Ian Osgood

var last = 42, A = 3877, C = 29573, M = 139968;

function rand(max) {
  last = (last * A + C) % M;
  return max * last / M;
}

var ALU =
  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";

var IUB = {
  a:0.27, c:0.12, g:0.12, t:0.27,
  B:0.02, D:0.02, H:0.02, K:0.02,
  M:0.02, N:0.02, R:0.02, S:0.02,
  V:0.02, W:0.02, Y:0.02
}

var HomoSap = {
  a: 0.3029549426680,
  c: 0.1979883004921,
  g: 0.1975473066391,
  t: 0.3015094502008
}

function makeCumulative(table) {
  var last = null;
  for (var c in table) {
    if (last) table[c] += table[last];
    last = c;
  }
}

function fastaRepeat(n, seq) {
  var seqi = 0, lenOut = 60;
  while (n>0) {
    if (n0) {
    if (n