org.snpeff.snpEffect.testCases.unity.TestCasesStructuralDel Maven / Gradle / Ivy
Go to download
Show more of this group Show more artifacts with this name
Show all versions of SnpEff Show documentation
Show all versions of SnpEff Show documentation
Variant annotation and effect prediction package.
The newest version!
package org.snpeff.snpEffect.testCases.unity;
import java.util.HashSet;
import java.util.Set;
import org.junit.Assert;
import org.junit.Test;
import org.snpeff.interval.Gene;
import org.snpeff.interval.Transcript;
import org.snpeff.interval.Variant;
import org.snpeff.interval.Variant.VariantType;
import org.snpeff.snpEffect.EffectType;
import org.snpeff.snpEffect.HgvsDna;
import org.snpeff.snpEffect.HgvsProtein;
import org.snpeff.snpEffect.VariantEffect;
import org.snpeff.snpEffect.VariantEffect.EffectImpact;
import org.snpeff.snpEffect.VariantEffects;
import org.snpeff.util.Gpr;
import org.snpeff.vcf.EffFormatVersion;
import org.snpeff.vcf.VcfEffect;
/**
* Test case
* Gene: geneId1
* 1:957-1157, strand: +, id:transcript_0, Protein
* Exons:
* 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt
* 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact
* 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac
* CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac
* Protein : VA*ILYSLAIVVLLTRHG?
*
*
*
* 1
* 0 1
* 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5
* 789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567
* gttgcttgaatactgtatagccttgccattgt........................................................tgtgttgctaact..........................................................................................agacatggac
* V A * I L Y S L A I V V L L T R H G
* 01201201201201201201201201201201 2012012012012 0120120120
* >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-------------------------------------------------------->>>>>>>>>>>>>------------------------------------------------------------------------------------------>>>>>>>>>>
* | | | | | |
* | | | | | ^1157
* | | | | ^1148
* | | | ^1057
* | | ^1045
* | ^988
* ^957
*
*
* Gene: geneId2
* 1:2066-2141, strand: +, id:transcript_1, Protein
* Exons:
* 1:2066-2069 'exon_1_0', rank: 1, frame: ., sequence: actt
* 1:2084-2089 'exon_1_1', rank: 2, frame: ., sequence: cccttt
* 1:2116-2126 'exon_1_2', rank: 3, frame: ., sequence: tacgcccacgt
* 1:2133-2141 'exon_1_3', rank: 4, frame: ., sequence: ccgccgctg
* CDS : acttcccttttacgcccacgtccgccgctg
* Protein : TSLLRPRPPL
*
*
*
* 1
* 7 8 9 0 1 2 3 4
* 6789012345678901234567890123456789012345678901234567890123456789012345678901
* actt..............cccttt..........................tacgcccacgt......ccgccgctg
* T S L L R P R P P L
* 0120 120120 12012012012 012012012
* >>>>-------------->>>>>>-------------------------->>>>>>>>>>>------>>>>>>>>>
* | | | | | | | |
* | | | | | | | ^2141
* | | | | | | ^2133
* | | | | | ^2126
* | | | | ^2116
* | | | ^2089
* | | ^2084
* | ^2069
* ^2066
*
*/
public class TestCasesStructuralDel extends TestCasesBase {
EffFormatVersion formatVersion = EffFormatVersion.FORMAT_ANN;
public TestCasesStructuralDel() {
super();
}
Set arrayToSet(String array[]) {
Set set = new HashSet<>();
if (array != null) {
for (String h : array)
set.add(h);
}
return set;
}
protected void checkEffects(Variant variant, EffectType expEffs[], String expHgvsp[], String expHgvsc[], EffectImpact expectedImpact, String expAnns[]) {
// Convert to sets
Set expectedEffs = new HashSet<>();
if (expEffs != null) {
for (EffectType et : expEffs)
expectedEffs.add(et);
}
Set expectedHgvsp = arrayToSet(expHgvsp);
Set expectedHgvsc = arrayToSet(expHgvsc);
Set expectedAnns = arrayToSet(expAnns);
// Initialize
initSnpEffPredictor();
if (verbose) {
Gpr.debug("Variant: " + variant);
for (Gene g : genome.getGenes()) {
Gpr.debug("\tGene: " + g.getId() + "\t" + gene.getStart() + " - " + gene.getEnd());
for (Transcript tr : g)
Gpr.debug(tr + "\n\n" + tr.toStringAsciiArt(true));
}
}
// Calculate effects
VariantEffects effects = snpEffectPredictor.variantEffect(variant);
if (verbose) Gpr.debug("VariantEffects: " + effects);
// Checknumber of results
Assert.assertEquals(true, effects.size() >= 1);
Set effs = new HashSet<>();
Set hgvscs = new HashSet<>();
Set hgvsps = new HashSet<>();
Set anns = new HashSet<>();
boolean impactOk = false;
for (VariantEffect varEff : effects) {
effs.addAll(varEff.getEffectTypes());
HgvsDna hgvsc = new HgvsDna(varEff);
String hgvsDna = hgvsc.toString();
hgvscs.add(hgvsDna);
HgvsProtein hgvsp = new HgvsProtein(varEff);
String hgvsProt = hgvsp.toString();
hgvsps.add(hgvsProt);
impactOk |= (varEff.getEffectImpact() == expectedImpact);
// Create VcfEffect
VcfEffect vcfEffect = new VcfEffect(varEff, formatVersion);
String annField = vcfEffect.toString();
anns.add(annField);
if (verbose) Gpr.debug("Effect: " + varEff.toStr() //
+ "\n\tHGVS.c: " + hgvsDna //
+ "\n\tHGVS.p: " + hgvsProt //
+ "\n\tANN : " + annField //
);
}
// Check effects
Assert.assertTrue("Effects do not match" //
+ "\n\tExpected : " + expectedEffs //
+ "\n\tFound : " + effs//
, effs.containsAll(expectedEffs) //
);
// Check impact
Assert.assertTrue("Effect impact '" + expectedImpact + "' not found", impactOk);
// Check HGVS.c
Assert.assertTrue("HGVS.c do not match" //
+ "\n\tExpected : " + expectedHgvsc //
+ "\n\tFound : " + hgvscs//
, hgvscs.containsAll(expectedHgvsc) //
);
// Check HGVS.p
Assert.assertTrue("HGVS.p do not match" //
+ "\n\tExpected : " + expectedHgvsp //
+ "\n\tFound : " + hgvsps//
, hgvsps.containsAll(expectedHgvsp) //
);
// Check ANN fields
Assert.assertTrue("ANN fields do not match" //
+ "\n\tExpected : " + expectedAnns //
+ "\n\tFound : " + anns //
, anns.containsAll(expectedAnns) //
);
}
@Override
protected void init() {
randSeed = 20151205;
genomeName = "testCase";
addUtrs = false;
onlyPlusStrand = true;
onlyMinusStrand = false;
numGenes = 2;
maxGeneLen = 1000;
maxTranscripts = 1;
maxExons = 5;
minExons = 2;
shiftHgvs = false;
initRand();
}
/**
* Deletion Whole gene / whole transcript
*/
@Test
public void test01_delGene() {
Gpr.debug("Test");
// Create variant
Variant variant = new Variant(chromosome, 950, 2500, "");
variant.setVariantType(VariantType.DEL);
EffectType expEffs[] = { EffectType.GENE_DELETED };
String expHgvsc[] = null;
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, null, expHgvsc, expectedImpact, null);
}
/**
* Deletion Whole gene / whole transcript
*/
@Test
public void test01_delTr() {
Gpr.debug("Test");
// Create variant
// Note that Gene ends at 1216, so this variant covers transcript (but not gene)
Variant variant = new Variant(chromosome, 950, 1200, "");
variant.setVariantType(VariantType.DEL);
EffectType expEffs[] = { EffectType.TRANSCRIPT_DELETED };
String expHgvsc[] = null;
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, null, expHgvsc, expectedImpact, null);
}
/**
* Deletion One coding exon
*/
@Test
public void test02() {
Gpr.debug("Test");
Variant variant = new Variant(chromosome, 1040, 1100, "");
variant.setVariantType(VariantType.DEL);
EffectType expEffs[] = { EffectType.EXON_DELETED };
String expHgvsc[] = { "c.33-5_45+43del" };
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, null, expHgvsc, expectedImpact, null);
}
/**
* Deletion two coding exons (within the same gene)
*/
@Test
public void test03() {
Gpr.debug("Test");
Variant variant = new Variant(chromosome, 1040, 1160, "");
variant.setVariantType(VariantType.DEL);
EffectType expEffs[] = { EffectType.EXON_DELETED };
String expHgvsc[] = { "c.33-5_*3del" };
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, null, expHgvsc, expectedImpact, null);
}
/**
* Deletion Part of one coding exon
*/
@Test
public void test04() {
Gpr.debug("Test");
int start = 1040;
int end = 1050;
Variant variant = new Variant(chromosome, start, chromoSequence.substring(start, end + 1), "", "");
EffectType expEffs[] = {};
String expHgvsc[] = { "c.33-5_38delTTGCGCAGCTT" };
String expHgvsp[] = { "p.Val12_Leu13del" };
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, expHgvsp, expHgvsc, expectedImpact, null);
}
/**
* Deletion Part of two coding exons (within the same gene)
*/
@Test
public void test05() {
Gpr.debug("Test");
int start = 1050;
int end = 1150;
Variant variant = new Variant(chromosome, start, chromoSequence.substring(start, end + 1), "", "");
EffectType expEffs[] = { EffectType.FRAME_SHIFT };
String expHgvsc[] = { "c.38_48del" };
String expHgvsp[] = { "p.Leu13fs" };
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, expHgvsp, expHgvsc, expectedImpact, null);
}
/**
* Deletion one genes and part of another gene
*/
@Test
public void test06() {
Gpr.debug("Test");
int start = 1050;
int end = 2160;
Variant variant = new Variant(chromosome, start, chromoSequence.substring(start, end + 1), "", "");
EffectType expEffs[] = { EffectType.EXON_DELETED //
, EffectType.CODON_DELETION //
, EffectType.TRANSCRIPT_DELETED //
};
String expHgvsc[] = { "n.1051_2161del" };
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, null, expHgvsc, expectedImpact, null);
}
/**
* Deletion after gene's coding region (LOW impact)
*/
@Test
public void test07() {
Gpr.debug("Test");
int start = 1100;
int end = 2000;
Variant variant = new Variant(chromosome, start, chromoSequence.substring(start, end + 1), "", "");
EffectType expEffs[] = { EffectType.EXON_DELETED };
String expHgvsc[] = { "n.1101_2001del" };
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, null, expHgvsc, expectedImpact, null);
}
/**
* Deletion Part of two genes cutting on introns
*/
@Test
public void test08() {
Gpr.debug("Test");
int start = 1100;
int end = 2075;
Variant variant = new Variant(chromosome, start, chromoSequence.substring(start, end + 1), "", "");
EffectType expEffs[] = { EffectType.GENE_FUSION };
String expHgvsc[] = { "n.1101_2076del" };
String expHgvsp[] = {};
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, expHgvsp, expHgvsc, expectedImpact, null);
}
/**
* Deletion Part of two genes cutting exons
*/
@Test
public void test09() {
Gpr.debug("Test");
int start = 1050;
int end = 2120;
Variant variant = new Variant(chromosome, start, chromoSequence.substring(start, end + 1), "", "");
EffectType expEffs[] = { EffectType.GENE_FUSION };
String expHgvsc[] = { "n.1051_2121del" };
String expHgvsp[] = {};
EffectImpact expectedImpact = EffectImpact.HIGH;
checkEffects(variant, expEffs, expHgvsp, expHgvsc, expectedImpact, null);
}
/**
* Deletion Intron
*/
@Test
public void test10() {
Gpr.debug("Test");
int start = 991;
int end = 1020;
Variant variant = new Variant(chromosome, start, chromoSequence.substring(start, end + 1), "", "");
EffectType expEffs[] = { EffectType.INTRON };
String expHgvsc[] = { "c.32+3_33-25delGTTGCTCATAGCTAATCTCGTGGAGACTAA" };
EffectImpact expectedImpact = EffectImpact.MODIFIER;
checkEffects(variant, expEffs, null, expHgvsc, expectedImpact, null);
}
}
© 2015 - 2025 Weber Informatics LLC | Privacy Policy