g0101_0200.s0187_repeated_dna_sequences.Solution Maven / Gradle / Ivy
package g0101_0200.s0187_repeated_dna_sequences;
// #Medium #String #Hash_Table #Bit_Manipulation #Sliding_Window #Hash_Function #Rolling_Hash
// #Data_Structure_II_Day_9_String #Udemy_Strings
// #2022_06_27_Time_29_ms_(77.11%)_Space_74.1_MB_(6.94%)
import java.util.ArrayList;
import java.util.Collections;
import java.util.List;
/**
* 187 - Repeated DNA Sequences\.
*
* Medium
*
* The **DNA sequence** is composed of a series of nucleotides abbreviated as `'A'`, `'C'`, `'G'`, and `'T'`.
*
* * For example, `"ACGAATTCCG"` is a **DNA sequence**.
*
* When studying **DNA** , it is useful to identify repeated sequences within the DNA.
*
* Given a string `s` that represents a **DNA sequence** , return all the **`10`\-letter-long** sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in **any order**.
*
* **Example 1:**
*
* **Input:** s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
*
* **Output:** ["AAAAACCCCC","CCCCCAAAAA"]
*
* **Example 2:**
*
* **Input:** s = "AAAAAAAAAAAAA"
*
* **Output:** ["AAAAAAAAAA"]
*
* **Constraints:**
*
* * 1 <= s.length <= 105
* * `s[i]` is either `'A'`, `'C'`, `'G'`, or `'T'`.
**/
public class Solution {
public List findRepeatedDnaSequences(String s) {
if (s.length() < 10) {
return Collections.emptyList();
}
boolean[] seen = new boolean[1024 * 1024];
boolean[] added = new boolean[1024 * 1024];
char[] chars = s.toCharArray();
int buf = 0;
int[] map = new int[128];
map['A'] = 0;
map['C'] = 1;
map['G'] = 2;
map['T'] = 3;
List ans = new ArrayList<>(s.length() / 2);
for (int i = 0; i < 10; i++) {
buf = (buf << 2) + map[chars[i]];
}
seen[buf] = true;
for (int i = 10; i < chars.length; i++) {
buf = ((buf << 2) & 0xFFFFF) + map[chars[i]];
if (seen[buf]) {
if (!added[buf]) {
ans.add(new String(chars, i - 9, 10));
added[buf] = true;
}
} else {
seen[buf] = true;
}
}
return ans;
}
}
© 2015 - 2025 Weber Informatics LLC | Privacy Policy