• Home
• com.github.javadev
• leetcode-in-java21
• 1.30
• source code
• readme.md

×

Project download

Many resources are needed to download a project. Please understand that we have to compensate our server costs. Thank you in advance.
Project price only 1 $

You can buy this project and download/modify it how often you want.

g0101_0200.s0187_repeated_dna_sequences.readme.md Maven / Gradle / Ivy

187\. Repeated DNA Sequences

Medium

The **DNA sequence** is composed of a series of nucleotides abbreviated as `'A'`, `'C'`, `'G'`, and `'T'`.

*   For example, `"ACGAATTCCG"` is a **DNA sequence**.

When studying **DNA**, it is useful to identify repeated sequences within the DNA.

Given a string `s` that represents a **DNA sequence**, return all the **`10`\-letter-long** sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in **any order**.

**Example 1:**

**Input:** s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

**Output:** ["AAAAACCCCC","CCCCCAAAAA"] 

**Example 2:**

**Input:** s = "AAAAAAAAAAAAA"

**Output:** ["AAAAAAAAAA"] 

**Constraints:**

*   1 <= s.length <= 105
*   `s[i]` is either `'A'`, `'C'`, `'G'`, or `'T'`.