g0101_0200.s0187_repeated_dna_sequences.readme.md Maven / Gradle / Ivy
Go to download
Show more of this group Show more artifacts with this name
Show all versions of leetcode-in-java21 Show documentation
Show all versions of leetcode-in-java21 Show documentation
Java-based LeetCode algorithm problem solutions, regularly updated
The newest version!
187\. Repeated DNA Sequences
Medium
The **DNA sequence** is composed of a series of nucleotides abbreviated as `'A'`, `'C'`, `'G'`, and `'T'`.
* For example, `"ACGAATTCCG"` is a **DNA sequence**.
When studying **DNA**, it is useful to identify repeated sequences within the DNA.
Given a string `s` that represents a **DNA sequence**, return all the **`10`\-letter-long** sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in **any order**.
**Example 1:**
**Input:** s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
**Output:** ["AAAAACCCCC","CCCCCAAAAA"]
**Example 2:**
**Input:** s = "AAAAAAAAAAAAA"
**Output:** ["AAAAAAAAAA"]
**Constraints:**
* 1 <= s.length <= 105
* `s[i]` is either `'A'`, `'C'`, `'G'`, or `'T'`.
© 2015 - 2025 Weber Informatics LLC | Privacy Policy