All Downloads are FREE. Search and download functionalities are using the official Maven repository.

net.maizegenetics.analysis.gbs.neobio.FactorSequence Maven / Gradle / Ivy

Go to download

TASSEL is a software package to evaluate traits associations, evolutionary patterns, and linkage disequilibrium.

There is a newer version: 5.2.95
Show newest version
/*
 * FactorSequence.java
 *
 * Copyright 2003 Sergio Anibal de Carvalho Junior
 *
 * This file is part of NeoBio.
 *
 * NeoBio is free software; you can redistribute it and/or modify it under the terms of
 * the GNU General Public License as published by the Free Software Foundation; either
 * version 2 of the License, or (at your option) any later version.
 *
 * NeoBio is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
 * without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR
 * PURPOSE. See the GNU General Public License for more details.
 *
 * You should have received a copy of the GNU General Public License along with NeoBio;
 * if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330,
 * Boston, MA 02111-1307, USA.
 *
 * Proper attribution of the author as the source of the software would be appreciated.
 *
 * Sergio Anibal de Carvalho Junior		mailto:[email protected]
 * Department of Computer Science		http://www.dcs.kcl.ac.uk
 * King's College London, UK			http://www.kcl.ac.uk
 *
 * Please visit http://neobio.sourceforge.net
 *
 * This project was supervised by Professor Maxime Crochemore.
 *
 */

package net.maizegenetics.analysis.gbs.neobio;

import java.io.Reader;
import java.io.BufferedReader;
import java.io.IOException;

/**
 * This class builds a list of factors of a character sequence as induced by its
 * Lempel-Ziv (LZ78) factorisation. Each factor is enconded as the longest factor
 * previously seen plus one character.
 *
 * 

The input can come from any source, provided it is encapsulated in a proper * Reader instance. The stream is expected to be ready (i.e. the next * read operation must return the first character of the sequence) and it is * not closed when its end is reached, so the client is allowed to reset it and maybe use * it for another purpose.

* *

Sequences can contain letters only although lines started with the * COMMENT_CHAR character ('>') are regarded as comments and are completely * skipped. White spaces (including tabs, line feeds and carriage returns) are also * ignored throughout.

* *

This class uses a {@linkplain Trie} to keep track of a list of factors. Each node of * the trie contains a {@linkplain Factor} of the text. As the sequence is read from the * input, the trie is traversed as far as possible. When a leaf node is reached (which * means that the longest prefix of the input has been found), two tasks are * accomplished:

* *
    *
  • a new Factor is created with the character at the current position of * the input and the leaf node's factor; *
  • a new node is added to the trie with the character at the current position of the * input; *
* *

Each factor also receives a serial number according to the order they are found and * a pointer to the next factor (in that order) for fast access. This pointer, together * with the factor's ancestor pointer forms a doubly-linked list of factors. The original * text can then be reconstructed simply by following the linked list and writing out its * factors.

* *

As an example, the sequence ACTAAACCGCATTAATAATAAAA is parsed into the * following 12 factors:

* *
 * 0  ( , ) = empty
 * 1  (0,A) = A
 * 2  (0,C) = C
 * 3  (0,T) = T
 * 4  (1,A) = AA
 * 5  (1,C) = AC
 * 6  (2,G) = CG
 * 7  (2,A) = CA
 * 8  (3,T) = TT
 * 9  (4,T) = AAT
 * 10 (9,A) = AATA
 * 11 (4,A) = AAA
 *
 * serial # (prefix, new char) = factor text
 * 
* *

This class is used by {@linkplain CrochemoreLandauZivUkelson} algorithm to speed up * the classic dynamic programming approach to sequence alignment.

* * @author Sergio A. de Carvalho Jr. * @see Factor * @see Trie * @see CrochemoreLandauZivUkelson */ public class FactorSequence { /** * The character used to start a comment line in a sequence file. When this character * is found, the rest of the line is ignored. */ protected static final char COMMENT_CHAR = '>'; /** * A pointer to the root factor, the one that starts the list of factors. */ protected Factor root_factor; /** * The numbers of character represented by this sequence. */ protected int num_chars; /** * The numbers of factors generated by the LZ78 parsing of the sequence. */ protected int num_factors; /** * Creates a new instance of a FactorSequence, loading the sequence data * from the Reader input stream. A doubly-linked list of factors is built * according to its LZ78 factorisation. * * @param reader source of characters for this sequence * @throws IOException if an I/O exception occurs when reading the input * @throws InvalidSequenceException if the input does not contain a valid sequence */ public FactorSequence (Reader reader) throws IOException, InvalidSequenceException { BufferedReader input = new BufferedReader(reader); Trie root_node, current_node, new_node = null; Factor current_factor, last_factor, new_factor; int ch; char c; // create root factor and the root node of the trie root_factor = new Factor (); root_node = new Trie (root_factor); num_factors = 1; num_chars = 0; current_node = root_node; last_factor = root_factor; // read characters from the input while ((ch = input.read()) != -1) { c = (char) ch; if (c == COMMENT_CHAR) // it's a comment line: skip it! input.readLine(); // accept letters only else if (Character.isLetter(c)) { num_chars++; // walk down the trie as far as possible new_node = current_node.spellDown(c); if (new_node != null) { current_node = new_node; } else { // the longest factor of the input has been found, // now create a new factor from the current node's factor current_factor = (Factor) current_node.getData(); new_factor = new Factor (current_factor, num_factors, c); // add the new character to the trie as well current_node.add (new_factor, c); // set up a pointer from the last factor to the new one last_factor.setNext (new_factor); last_factor = new_factor; // restart at the root of the trie current_node = root_node; num_factors++; } } // anything else, except whitespaces, will throw an exception else if (!Character.isWhitespace(c)) throw new InvalidSequenceException ("Sequences can contain letters only."); } // if new_node is not null, the last factor is actually // not a new factor but a factor already created if (new_node != null) { // no new node is created, just point the last_factor to an // existing one that represents the last characters of the text last_factor.setNext((Factor) new_node.getData()); num_factors++; } // check if read anything useful! if (num_factors <= 1) throw new InvalidSequenceException ("Empty sequence."); } /** * Returns the root factor, the one that starts the list of factors. * * @return root factor */ public Factor getRootFactor () { return root_factor; } /** * Returns the number of factors produced by the LZ78 parsing of the text. * * @return number of factors */ public int numFactors() { return num_factors; } /** * Returns the number of characters of the original sequence. * * @return number of characters of the original sequence */ public int numChars () { return num_chars; } /** * Reconstructs the sequence from the list of factors induced by the LZ78 parsing of * the text. * * @return the original sequence */ public String toString () { StringBuffer buf = new StringBuffer(); Factor node; node = root_factor.getNext(); for (int i = 1; i < numFactors(); i++) { buf.append(node); node = node.getNext(); } return buf.toString(); } /** * Returns a string representation of the actual list of factors produced by the LZ78 * parsing of the text. Each factor is printed out in a separate line, in the order * they appear in the text, with its serial number, its ancestor's serial number, its * new character, length and a string representation of the factor itself. * * @return a string representation of the list of factors */ public String printFactors () { StringBuffer buf = new StringBuffer(); Factor factor; factor = root_factor.getNext(); for (int i = 1; i < numFactors(); i++) { buf.append (factor.getSerialNumber() + "\t<"); buf.append (factor.getAncestor().getSerialNumber() + " ,\t"); buf.append (factor.getNewChar() + ">\t"); buf.append (factor.length() + "\t" + factor + "\n"); factor = factor.getNext(); } buf.append(numFactors() + " factors\n"); return buf.toString(); } }




© 2015 - 2025 Weber Informatics LLC | Privacy Policy