
net.maizegenetics.dna.read.ReadUtils Maven / Gradle / Ivy
Go to download
Show more of this group Show more artifacts with this name
Show all versions of tassel Show documentation
Show all versions of tassel Show documentation
TASSEL is a software package to evaluate traits associations, evolutionary patterns, and linkage
disequilibrium.
/*
* To change this license header, choose License Headers in Project Properties.
* To change this template file, choose Tools | Templates
* and open the template in the editor.
*/
package net.maizegenetics.dna.read;
import java.util.HashMap;
/**
*
* @author Fei Lu
*/
public class ReadUtils {
/**Illumina TruSeq universal adaptor*/
public static String truSeqUAdaptor = "AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT";
/**Illumina TruSeq index adaptor part 1, before barcode*/
public static String truSeqIAdaptor1 = "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC";
/**Illumina TruSeq index adaptor part 2, after barcode*/
public static String truSeqIAdaptor2 = "ATCTCGTATGCCGTCTTCTGCTTG";
public static enum ReadFormat {
FastqText, FastqGzip
}
public static final HashMap baseCompleMap = new HashMap();
static {
baseCompleMap.put("A", "T");
baseCompleMap.put("T", "A");
baseCompleMap.put("G", "C");
baseCompleMap.put("C", "G");
baseCompleMap.put("N", "N");
baseCompleMap.put("a", "t");
baseCompleMap.put("t", "a");
baseCompleMap.put("g", "c");
baseCompleMap.put("c", "g");
baseCompleMap.put("n", "n");
}
}
© 2015 - 2025 Weber Informatics LLC | Privacy Policy