net.maizegenetics.analysis.gbs.neobio.FactorSequence Maven / Gradle / Ivy
/*
* FactorSequence.java
*
* Copyright 2003 Sergio Anibal de Carvalho Junior
*
* This file is part of NeoBio.
*
* NeoBio is free software; you can redistribute it and/or modify it under the terms of
* the GNU General Public License as published by the Free Software Foundation; either
* version 2 of the License, or (at your option) any later version.
*
* NeoBio is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
* without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License along with NeoBio;
* if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330,
* Boston, MA 02111-1307, USA.
*
* Proper attribution of the author as the source of the software would be appreciated.
*
* Sergio Anibal de Carvalho Junior mailto:[email protected]
* Department of Computer Science http://www.dcs.kcl.ac.uk
* King's College London, UK http://www.kcl.ac.uk
*
* Please visit http://neobio.sourceforge.net
*
* This project was supervised by Professor Maxime Crochemore.
*
*/
package net.maizegenetics.analysis.gbs.neobio;
import java.io.Reader;
import java.io.BufferedReader;
import java.io.IOException;
/**
* This class builds a list of factors of a character sequence as induced by its
* Lempel-Ziv (LZ78) factorisation. Each factor is enconded as the longest factor
* previously seen plus one character.
*
* The input can come from any source, provided it is encapsulated in a proper
* Reader
instance. The stream is expected to be ready (i.e. the next
* read
operation must return the first character of the sequence) and it is
* not closed when its end is reached, so the client is allowed to reset it and maybe use
* it for another purpose.
*
* Sequences can contain letters only although lines started with the
* COMMENT_CHAR
character ('>') are regarded as comments and are completely
* skipped. White spaces (including tabs, line feeds and carriage returns) are also
* ignored throughout.
*
* This class uses a {@linkplain Trie} to keep track of a list of factors. Each node of
* the trie contains a {@linkplain Factor} of the text. As the sequence is read from the
* input, the trie is traversed as far as possible. When a leaf node is reached (which
* means that the longest prefix of the input has been found), two tasks are
* accomplished:
*
*
* - a new
Factor
is created with the character at the current position of
* the input and the leaf node's factor;
* - a new node is added to the trie with the character at the current position of the
* input;
*
*
* Each factor also receives a serial number according to the order they are found and
* a pointer to the next factor (in that order) for fast access. This pointer, together
* with the factor's ancestor pointer forms a doubly-linked list of factors. The original
* text can then be reconstructed simply by following the linked list and writing out its
* factors.
*
* As an example, the sequence ACTAAACCGCATTAATAATAAAA
is parsed into the
* following 12 factors:
*
*
* 0 ( , ) = empty
* 1 (0,A) = A
* 2 (0,C) = C
* 3 (0,T) = T
* 4 (1,A) = AA
* 5 (1,C) = AC
* 6 (2,G) = CG
* 7 (2,A) = CA
* 8 (3,T) = TT
* 9 (4,T) = AAT
* 10 (9,A) = AATA
* 11 (4,A) = AAA
*
* serial # (prefix, new char) = factor text
*
*
* This class is used by {@linkplain CrochemoreLandauZivUkelson} algorithm to speed up
* the classic dynamic programming approach to sequence alignment.
*
* @author Sergio A. de Carvalho Jr.
* @see Factor
* @see Trie
* @see CrochemoreLandauZivUkelson
*/
public class FactorSequence
{
/**
* The character used to start a comment line in a sequence file. When this character
* is found, the rest of the line is ignored.
*/
protected static final char COMMENT_CHAR = '>';
/**
* A pointer to the root factor, the one that starts the list of factors.
*/
protected Factor root_factor;
/**
* The numbers of character represented by this sequence.
*/
protected int num_chars;
/**
* The numbers of factors generated by the LZ78 parsing of the sequence.
*/
protected int num_factors;
/**
* Creates a new instance of a FactorSequence
, loading the sequence data
* from the Reader
input stream. A doubly-linked list of factors is built
* according to its LZ78 factorisation.
*
* @param reader source of characters for this sequence
* @throws IOException if an I/O exception occurs when reading the input
* @throws InvalidSequenceException if the input does not contain a valid sequence
*/
public FactorSequence (Reader reader)
throws IOException, InvalidSequenceException
{
BufferedReader input = new BufferedReader(reader);
Trie root_node, current_node, new_node = null;
Factor current_factor, last_factor, new_factor;
int ch;
char c;
// create root factor and the root node of the trie
root_factor = new Factor ();
root_node = new Trie (root_factor);
num_factors = 1;
num_chars = 0;
current_node = root_node;
last_factor = root_factor;
// read characters from the input
while ((ch = input.read()) != -1)
{
c = (char) ch;
if (c == COMMENT_CHAR)
// it's a comment line: skip it!
input.readLine();
// accept letters only
else if (Character.isLetter(c))
{
num_chars++;
// walk down the trie as far as possible
new_node = current_node.spellDown(c);
if (new_node != null)
{
current_node = new_node;
}
else
{
// the longest factor of the input has been found,
// now create a new factor from the current node's factor
current_factor = (Factor) current_node.getData();
new_factor = new Factor (current_factor, num_factors, c);
// add the new character to the trie as well
current_node.add (new_factor, c);
// set up a pointer from the last factor to the new one
last_factor.setNext (new_factor);
last_factor = new_factor;
// restart at the root of the trie
current_node = root_node;
num_factors++;
}
}
// anything else, except whitespaces, will throw an exception
else if (!Character.isWhitespace(c))
throw new InvalidSequenceException
("Sequences can contain letters only.");
}
// if new_node is not null, the last factor is actually
// not a new factor but a factor already created
if (new_node != null)
{
// no new node is created, just point the last_factor to an
// existing one that represents the last characters of the text
last_factor.setNext((Factor) new_node.getData());
num_factors++;
}
// check if read anything useful!
if (num_factors <= 1)
throw new InvalidSequenceException ("Empty sequence.");
}
/**
* Returns the root factor, the one that starts the list of factors.
*
* @return root factor
*/
public Factor getRootFactor ()
{
return root_factor;
}
/**
* Returns the number of factors produced by the LZ78 parsing of the text.
*
* @return number of factors
*/
public int numFactors()
{
return num_factors;
}
/**
* Returns the number of characters of the original sequence.
*
* @return number of characters of the original sequence
*/
public int numChars ()
{
return num_chars;
}
/**
* Reconstructs the sequence from the list of factors induced by the LZ78 parsing of
* the text.
*
* @return the original sequence
*/
public String toString ()
{
StringBuffer buf = new StringBuffer();
Factor node;
node = root_factor.getNext();
for (int i = 1; i < numFactors(); i++)
{
buf.append(node);
node = node.getNext();
}
return buf.toString();
}
/**
* Returns a string representation of the actual list of factors produced by the LZ78
* parsing of the text. Each factor is printed out in a separate line, in the order
* they appear in the text, with its serial number, its ancestor's serial number, its
* new character, length and a string representation of the factor itself.
*
* @return a string representation of the list of factors
*/
public String printFactors ()
{
StringBuffer buf = new StringBuffer();
Factor factor;
factor = root_factor.getNext();
for (int i = 1; i < numFactors(); i++)
{
buf.append (factor.getSerialNumber() + "\t<");
buf.append (factor.getAncestor().getSerialNumber() + " ,\t");
buf.append (factor.getNewChar() + ">\t");
buf.append (factor.length() + "\t" + factor + "\n");
factor = factor.getNext();
}
buf.append(numFactors() + " factors\n");
return buf.toString();
}
}