• Home
• net.sourceforge.jmol
• jmol
• 14.12.1
• source code
• DSSR0.java

×

Project download

Many resources are needed to download a project. Please understand that we have to compensate our server costs. Thank you in advance.
Project price only 1 $

You can buy this project and download/modify it how often you want.

org.jmol.dssx.DSSR0 Maven / Gradle / Ivy

/* $RCSfile$
 * $Author: nicove $
 * $Date: 2007-03-25 06:44:28 -0500 (Sun, 25 Mar 2007) $
 * $Revision: 7224 $
 *
 * Copyright (C) 2004-2005  The Jmol Development Team
 *
 * Contact: [email protected]
 *
 *  This library is free software; you can redistribute it and/or
 *  modify it under the terms of the GNU Lesser General Public
 *  License as published by the Free Software Foundation; either
 *  version 2.1 of the License, or (at your option) any later version.
 *
 *  This library is distributed in the hope that it will be useful,
 *  but WITHOUT ANY WARRANTY; without even the implied warranty of
 *  MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
 *  Lesser General Public License for more details.
 *
 *  You should have received a copy of the GNU Lesser General Public
 *  License along with this library; if not, write to the Free Software
 *  Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
 */
package org.jmol.dssx;


/**
 * 
 * The original non-JSON parser for output from 3DNA web service.
 * 
 * load =1d66/dssr
 * 
 * also other annotations now,
 * 
 * load *1cbs/dom
 * 
 * calls EBI for the mmCIF file and also retrieves the domains mapping JSON
 * report.
 * 
 * 
 * load *1cbs/val
 * 
 * calls EBI for the mmCIF file and also retrieves the validation outliers JSON
 * report.
 * 
 * Bob Hanson July 2014
 * 
 * @author Bob Hanson [email protected]
 * 
 */
public class DSSR0 {// extends AnnotationParser {
//
//  private GenericLineReader reader;
//  private String line;
//  private Map dssr;
//  private Map htTemp;
//  private SB message;
//  private Map htPar;
//  private Lst> basePairs;
//
//  public DSSR0() {
//    // for reflection
//  }
//
//  @Override
//  public String processDSSR(Map info, GenericLineReader reader,
//                            String line0, Map htGroup1,
//                            Map modelMap) throws Exception {
//    info.put("dssr", dssr = new Hashtable());
//    htTemp = new Hashtable();
//    htPar = new Hashtable();
//    htPar.put("bp", new String[] { "bpShear", "bpStretch", "bpStagger",
//        "bpPropeller", "bpBuckle", "bpOpening" });
//    htPar.put("bpChiLambda", new String[] { "bpChi1", "bpLambda1", "bpChi2",
//        "bpLambda2" });
//    htPar.put("bpDistTor", new String[] { "bpDistC1C1", "bpDistNN",
//        "bpDistC6C8", "bpTorCNNC" });
//    htPar.put("step", new String[] { "stShift", "stSlide", "stRise", "stTilt",
//        "stRoll", "stTwist" });
//    htPar.put("hel", new String[] { "heXDisp", "heYDisp", "heRise", "heIncl",
//        "heTip", "heTwist" });
//
//    this.reader = reader;
//    message = new SB();
//    line = (line0 == null ? "" : line0.trim());
//    // output the header section with credits
//    skipTo("DSSR:", false);
//    addToMessages(null);
//    boolean haveHeader = false;
//    while (rd() != null) {
//      if (line.startsWith("List of")) {
//        int n = PT.parseInt(line.substring(8));
//        if (n < 0 || line.endsWith("files"))
//          continue;
//        if (line.indexOf("lone WC") >= 0)
//          line = PT.rep(line, "lone WC", "isolated WC");
//        addMessage(line);
//        line = PT.rep(PT.trim(line, "s"), " interaction", "");
//        int pt = "pair elix lice plet stem tack loop ulge tion ment otif pper turn bond file"
//            .indexOf(line.trim().substring(line.length() - 4));
//        //0    5    10        20        30        40        50        60
//        switch (pt) {
//        case 0:
//          readPairs(n);
//          break;
//        case 5:
//        case 10:
//          getHelixOrStem(n, "helices", "helix", true);
//          break;
//        case 15:
//          readNTList(null, "multiplets", n);
//          break;
//        case 20:
//          getHelixOrStem(n, "stems", "stem", false);
//          break;
//        case 25:
//          readStacks(n);
//          break;
//        case 30:
//          readLoops(n); // hairpin, internal, or kissing
//          break;
//        case 35:
//          readBulges(n);
//          break;
//        case 40:
//          readJunctions(n);
//          break;
//        case 45:
//          readNTList(null, "singleStranded", n);
//          break;
//        case 50:
//          readMotifs(n);
//          break;
//        case 55:
//          readNTList(null, "riboseZippers", n);
//          break;
//        case 60:
//          readTurns(n);
//          break;
//        case 65:
//          readHBonds(n);
//          break;
//        case 70: // files
//          break;
//        default:
//          addMessage("DSSRParser ignored: " + line);
//          break;
//        }
//      } else if (!haveHeader && line.startsWith("Date and time")) {
//        haveHeader = true;
//        addToMessages("");
//      } else if (line.startsWith("Secondary structures in dot-bracket")) {
//        readStructure();
//      } else if (line.startsWith("Mapping of")) {
//        mapGroups(htGroup1);
//      }
//    }
//    dssr.put("summary", message.toString());
//    return message.toString();
//  }
//
//  //Mapping of 76 nucleotide identifiers
//  //  no.    3-letter   1-letter    idstr
//  //  58     1MA         a        [1MA]58:A
//  //  76       A         A        [A]76:A
//  //0         1         2
//  //0123456789012345678901
//
//  private void mapGroups(Map map) throws Exception {
//    rd();
//    int n = 0;
//    String s = "";
//    if (NucleicPolymer.htGroup1 == null)
//      NucleicPolymer.htGroup1 = new Hashtable();
//    while (rd() != null && line.length() > 21) {
//      String g3 = line.substring(9, 12).trim();
//      String g1 = line.substring(21, 22);
//      if ("ACGTU".indexOf(g1) < 0) {
//        NucleicPolymer.htGroup1.put(g3, g1);
//        String key = " " + g3 + "(" + g1 + ")";
//        if (s.indexOf(key) < 0) {
//          n++;
//          s += key;
//        }
//        if (map != null)
//          map.put(g3, g1);
//      }
//    }
//    if (n > 0)
//      addMessage(n + " nonstandard base" + (n > 1 ? "s" : "") + ":" + s);
//  }
//
//  //  >1ehz nts=18 [whole]
//  //  TAACGGTTA&TAACCGTTA
//  //  .((((((((&)))))))).
//
//  private void readStructure() throws Exception {
//    addMessage("");
//    addMessage(line);
//    addMessage(rd());
//    dssr.put("seq", rd());
//    addMessage(line);
//    dssr.put("dbn", rd());
//    addToMessages(line);
//    addMessage("");
//  }
//
//  //  List of 39 H-bonds
//  //   15   578  #1     p    2.768 O/N [email protected] [email protected]
//  //   35   555  #2     p    2.776 O/N [email protected] [email protected]
//  //   36   554  #3     p    2.826 N/O [email protected] [email protected]
//  //   55   537  #4     p    2.965 O/N [email protected] [email protected]
//
//  private void readHBonds(int n) throws Exception {
//    Lst> list = newList("hBonds");
//    for (int i = 0; i < n; i++) {
//      Map data = new Hashtable();
//      String[] tokens = PT.getTokens(rd());
//      data.put("atno1", Integer.valueOf(PT.parseInt(tokens[0])));
//      data.put("atno2", Integer.valueOf(PT.parseInt(tokens[1])));
//      data.put("id", tokens[2]);
//      data.put("hbType", tokens[3]);
//      data.put("distAng", Float.valueOf(tokens[4]));
//      int pt = (tokens.length > 8 ? 6 : 5);
//      data.put("energy", Float.valueOf(pt == 6 ? tokens[5] : "0"));
//      data.put("label", tokens[pt++]);
//      data.put("atom1", fix(tokens[pt++], true));
//      data.put("atom2", fix(tokens[pt++], true));
//      // --more option:
//      //  1678  1703  #187   p    2.722    1.438 O/N [email protected] [email protected] primary
//      if (pt < tokens.length)
//        data.put("primary", Boolean.valueOf(tokens[pt++].equals("primary")));
//      list.addLast(data);
//    }
//  }
//
//  private void addToMessages(String s) throws Exception {
//    if (s != null)
//      addMessage(s);
//    while (line != null && line.length() > 0 && line.indexOf("****") < 0) {
//      addMessage(s == null ? line.trim() : line);
//      rd();
//    }
//  }
//
//  private void addMessage(String s) {
//    message.append(s).append("\n");
//
//  }
//
//  private Lst> newList(String name) {
//    Lst> list = new Lst>();
//    if (name != null)
//      dssr.put(name, list);
//    return list;
//  }
//
//  /**
//   * List of 40 coaxial stacks
//   * 
//   * 1 Helix#1 contains 4 stems: [#1,#2,#3,#4]
//   * 
//   * 2 Helix#4 contains 4 stems: [#6,#7,#9,#13]
//   * 
//   * 3 Helix#10 contains 3 stems: [#16,#17,#18]
//   * 
//   * 4 Helix#13 contains 2 stems: [#21,#22]
//   * 
//   * @param n
//   * @throws Exception
//   */
//  private void readStacks(int n) throws Exception {
//    Lst> list = newList("coaxialStacks");
//    for (int i = 0; i < n; i++) {
//      Map data = new Hashtable();
//      String[] tokens = PT.getTokens(rd());
//      data.put("helix", tokens[1]);
//      data.put("stemCount", Integer.valueOf(tokens[3]));
//      data.put("stems", tokens[5]);
//      data.put("basePairs", getLinkNTList(tokens[5], "stem", null));
//      list.addLast(data);
//    }
//  }
//
//  /**
//   * Default for no real processing -- just the lines
//   * 
//   * @param key
//   * @param n
//   * @return list of information
//   * @throws Exception
//   */
//  private Lst readInfo(String key, int n) throws Exception {
//    Lst list = new Lst();
//    if (key != null)
//      dssr.put(key, list);
//    for (int i = 0; i < n; i++)
//      list.addLast(rd());
//    return list;
//  }
//
//  //  ****************************************************************************
//  //  Note: for the various types of loops listed below, numbers within the first
//  //      set of brackets are the number of loop nts, and numbers in the second
//  //      set of brackets are the identities of the stems (positive number) or
//  //      lone WC/wobble pairs (negative numbers) to which they are linked.
//  //
//  //  ****************************************************************************
//  //  List of 68 hairpin loops
//  //   1 hairpin loop: nts=10; [8]; linked by [#7]
//  //     nts=10 UGCCAAGCUG 0.U55,0.G56,0.C57,0.C58,0.A59,0.A60,0.G61,0.C62,0.U63,0.G64
//  //       nts=8 GCCAAGCU 0.G56,0.C57,0.C58,0.A59,0.A60,0.G61,0.C62,0.U63
//  //
//  //
//  //  ****************************************************************************
//  //  List of 67 internal loops
//  //   1 symmetric internal loop: nts=14; [5,5]; linked by [#1,#-1]
//  //     nts=14 GUGGAUUAUGAAAU 0.G21,0.U22,0.G23,0.G24,0.A25,0.U26,0.U27,0.A516,0.U517,0.G518,0.A519,0.A520,0.A521,0.U522
//  //       nts=5 UGGAU 0.U22,0.G23,0.G24,0.A25,0.U26
//  //       nts=5 UGAAA 0.U517,0.G518,0.A519,0.A520,0.A521
//  //   2 asymmetric internal loop: nts=7; [1,2]; linked by [#4,#-2]
//  //     nts=7 GCGCAAC 0.G39,0.C40,0.G41,0.C440,0.A441,0.A442,0.C443
//  //       nts=1 C 0.C40
//  //       nts=2 AA 0.A441,0.A442
//  //   3 symmetric internal loop: nts=8; [2,2]; linked by [#8,#9]
//  //     nts=8 CAAGCACG 0.C58,0.A59,0.A60,0.G61,0.C85,0.A86,0.C87,0.G88
//  //       nts=2 AA 0.A59,0.A60
//  //       nts=2 AC 0.A86,0.C87
//  //
//  //
//  //  List of 1 kissing loop interaction
//  //   1 stem #29 between hairpin loops #12 and #50
//  //
//  //
//
//  private void readLoops(int n) throws Exception {
//    if (line.indexOf("internal") >= 0) {
//      readSets("internalLoops", n, 2, 4);
//    } else if (line.indexOf("hairpin") >= 0) {
//      readSets("hairpinLoops", n, 1, 3);
//    } else if (line.indexOf("kissing") >= 0) {
//      readSets("kissingLoops", n, -1, -1);
//    }
//  }
//
//  //  List of 35 junctions
//  //   1 3-way junction: nts=12; [0,6,0]; linked by [#-1,#2,#-14]
//  //     nts=12 UGCUGCAAAGCA 0.U27,0.G28,0.C480,0.U481,0.G482,0.C483,0.A484,0.A485,0.A486,0.G487,0.C515,0.A516
//  //       nts=0
//  //       nts=6 UGCAAA 0.U481,0.G482,0.C483,0.A484,0.A485,0.A486
//  //       nts=0
//  //   2 3-way junction: nts=27; [2,15,4]; linked by [#2,#3,#30]
//  //     nts=27 CUCGCGAUAGUGAACAAGUAGCGAACG 0.C29,0.U30,0.C31,0.G32,0.C451,0.G452,0.A453,0.U454,0.A455,0.G456,0.U457,0.G458,0.A459,0.A460,0.C461,0.A462,0.A463,0.G464,0.U465,0.A466,0.G467,0.C474,0.G475,0.A476,0.A477,0.C478,0.G479
//  //       nts=2 UC 0.U30,0.C31
//  //       nts=15 GAUAGUGAACAAGUA 0.G452,0.A453,0.U454,0.A455,0.G456,0.U457,0.G458,0.A459,0.A460,0.C461,0.A462,0.A463,0.G464,0.U465,0.A466
//  //       nts=4 GAAC 0.G475,0.A476,0.A477,0.C478
//  //   3 6-way junction: nts=36; [0,3,9,3,3,6]; linked by [#-2,#5,#-4,#15,#16,#18]
//  //     nts=36 GCGGAACGGAACAGAAAAUGAUGUACAGCUAAACAC 0.G41,0.C42,0.G149,0.G150,0.A151,0.A152,0.C153,0.G184,0.G185,0.A186,0.A187,0.C188,0.A189,0.G190,0.A191,0.A192,0.A193,0.A194,0.U202,0.G203,0.A204,0.U205,0.G206,0.U233,0.A234,0.C235,0.A236,0.G237,0.C433,0.U434,0.A435,0.A436,0.A437,0.C438,0.A439,0.C440
//  //       nts=0
//  //       nts=3 GAA 0.G150,0.A151,0.A152
//  //       nts=9 GAACAGAAA 0.G185,0.A186,0.A187,0.C188,0.A189,0.G190,0.A191,0.A192,0.A193
//  //       nts=3 GAU 0.G203,0.A204,0.U205
//  //       nts=3 ACA 0.A234,0.C235,0.A236
//  //       nts=6 UAAACA 0.U434,0.A435,0.A436,0.A437,0.C438,0.A439
//
//  private void readJunctions(int n) throws Exception {
//    readSets("junctions", n, 0, 3);
//  }
//
//  //  ****************************************************************************
//  //  List of 38 bulges
//  //   1 bulge: nts=5; [0,1]; linked by [#3,#4]
//  //     nts=5 GCGAC 0.G33,0.C34,0.G448,0.A449,0.C450
//  //       nts=0
//  //       nts=1 A 0.A449
//  //   2 bulge: nts=5; [0,1]; linked by [#-4,#14]
//  //     nts=5 CCGAG 0.C153,0.C154,0.G182,0.A183,0.G184
//  //       nts=0
//  //       nts=1 A 0.A183
//
//  private void readBulges(int n) throws Exception {
//    readSets("bulges", n, 2, 2);
//  }
//
//  private void readSets(String key, int n, int nway, int ptnts)
//      throws Exception {
//    Lst> sets = newList(key);
//    boolean isJunction = (nway == 0);
//    boolean isKissingLoop = (ptnts == -1);
//    for (int i = 0; i < n; i++) {
//      Map set = new Hashtable();
//      String[] tokens = PT.getTokens(rd());
//      set.put("id", tokens[0]);
//      htTemp.put(key + tokens[0], set);
//      Lst