All Downloads are FREE. Search and download functionalities are using the official Maven repository.

org.biojava.bio.program.sax.FastaSequenceSAXParser Maven / Gradle / Ivy

The newest version!
/*
 *                    BioJava development code
 *
 * This code may be freely distributed and modified under the
 * terms of the GNU Lesser General Public Licence.  This should
 * be distributed with the code.  If you do not have a copy,
 * see:
 *
 *      http://www.gnu.org/copyleft/lesser.html
 *
 * Copyright for this code is held jointly by the individual
 * authors.  These should be listed in @author doc comments.
 *
 * For more information on the BioJava project and its aims,
 * or to join the biojava-l mailing list, visit the home page
 * at:
 *
 *      http://www.biojava.org/
 *
 */
package org.biojava.bio.program.sax;

import java.io.BufferedReader;
import java.io.IOException;
import java.util.StringTokenizer;

import org.xml.sax.Attributes;
import org.xml.sax.InputSource;
import org.xml.sax.SAXException;
import org.xml.sax.helpers.AttributesImpl;

/**
 * A SAX2 parser for dealing with multiple sequences in
 * FASTA format.
 *
 * For example:
 * 
 * >Seq1
 * GATCGATCGTAGCTAGATGCTAGCATGCTAGCTGACTGATCGATCGTAGCTAGCTAGCTGACTG
 * >Seq2
 * GATCGATCGTAGCTAGATGCTAGCATGCTAGCTGACTGATCGATCGTAGCTAGCTAGCTGACTG
 * 
*

* * Copyright © 2000,2001 Cambridge Antibody Technology. *

* Primary author -

    *
  • Simon Brocklehurst (CAT) *
* Other authors -
    *
  • Neil Benn (CAT) *
  • Lawrence Bower (CAT) *
  • Derek Crockford (CAT) *
  • Tim Dilks (CAT) *
  • Colin Hardman (CAT) *
  • Stuart Johnston (CAT) *
* * @author Cambridge Antibody Technology (CAT) * @author Greg Cox * @version 1.0 * */ public class FastaSequenceSAXParser extends AbstractNativeAppSAXParser { private AttributesImpl oAtts = new AttributesImpl(); private QName oAttQName = new QName(this); private char[] aoChars; private StringBuffer oSeqName = new StringBuffer(); private StringBuffer oSeq = new StringBuffer(); private boolean tOnFirst = true; private static final int STARTUP = 0; private static final int IN_STREAM = 1; /** * Initialises internal state * Sets namespace prefix to "biojava" */ public FastaSequenceSAXParser() { iState = STARTUP; this.setNamespacePrefix("biojava"); } /** * Describe 'parse' method here. * * @param poSource - */ public void parse(InputSource poSource ) throws IOException,SAXException { BufferedReader oContents; String oLine = null; //Use method form superclass oContents = this.getContentStream(poSource); // loop over file try { // loop over file oLine = oContents.readLine(); while (oLine != null) { //System.out.println(oLine); this.interpret(oContents,oLine); oLine = oContents.readLine(); } // end while } catch (java.io.IOException x) { System.out.println(x.getMessage()); System.out.println("Stream read interupted"); } // end try/catch //at end of stream... //do final sequence this.emitSequence(); this.endElement(new QName(this, this.prefix("SequenceCollection"))); oContents.close(); } /** * Describe interpret method here. * * @param poContents a BufferedReader value * @param poLine a String value * @exception SAXException if an error occurs */ private void interpret(BufferedReader poContents, String poLine) throws SAXException { if (iState == STARTUP) { oAtts.clear(); this.startElement( new QName(this, this.prefix("SequenceCollection")), (Attributes)oAtts); this.changeState(IN_STREAM); } if (iState == IN_STREAM) { //look for the start of first record i.e.a header if ( poLine.startsWith(">") ) { if (!tOnFirst) { this.emitSequence(); } this.parseHeaderLine(poLine); oSeq.setLength(0); return; } else { this.appendSequence(poLine); } } } /** * Parse the header part of a record i.e. >myName, and * emit messages. * * @param poLine a String value */ private void parseHeaderLine(String poLine) { oSeqName.setLength(0); oSeqName.append(poLine.substring(1)); //flip flag to begin emitting sequence elements tOnFirst = false; //System.out.println(oSeqName); } /** * Builds up sequence data - NB white space is * removed. * * @param poLine a String value */ private void appendSequence(String poLine) { StringTokenizer oSt = new StringTokenizer(poLine,"\n\t\r "); while (oSt.hasMoreTokens()) { oSeq.append(oSt.nextToken()); } } /** * Describe emitSequence method here. * */ private void emitSequence() throws SAXException { oAtts.clear(); oAttQName.setQName("sequenceName"); oAtts.addAttribute(oAttQName.getURI(), oAttQName.getLocalName(), oAttQName.getQName(), "CDATA",oSeqName.substring(0)); this.startElement( new QName(this, this.prefix("Sequence")), (Attributes)oAtts); aoChars = oSeq.substring(0).toCharArray(); this.characters(aoChars,0,aoChars.length); this.endElement(new QName(this,this.prefix("Sequence"))); } }




© 2015 - 2025 Weber Informatics LLC | Privacy Policy